Others

All kinds of other codecs are categorized in "Others".


DNA

This implements the 8 methods of ATGC nucleotides following the rule of complementary pairing, according the literature about coding and computing of DNA sequences.

Codec Conversions Aliases Comment
dna (rule 1) text <-> DNA-1 dna1, dna-1, dna_1
dna (rule X) text <-> DNA-X ...
dna (rule 8) text <-> DNA-8 dna8, dna-8, dna_8
>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

Letter indices

This encodes consonants and/or vowels with their respective indices. This codec is case insensitive, strips white spaces and only applies to letters.

Codec Conversions Aliases Comment
consonant-indices text <-> text with consonant indices consonants_indices, consonants_index while decoding, searches from the longest match, possibly not producing the original input
vowel-indices text <-> text with vowel indices vowels_indices, vowels_index
consonant-vowel-indices text <-> text with consonant and vowel indices consonants-vowels_index prefixes consonants with C and vowels with V
>>> codext.encode("This is a test", "consonant-index")
'166I15I15A16E1516'
>>> codext.decode("166I15I15A16E1516", "consonant-index")
'THISISATEST'
>>> codext.encode("This is a test", "vowel-index")
'TH3S3S1T2ST'
>>> codext.decode("TH3S3S1T2ST", "vowel-index")
'THISISATEST'
>>> codext.encode("This is a test", "consonant-vowel-index")
'C16C6V3C15V3C15V1C16V2C15C16'
>>> codext.decode("C16C6V3C15V3C15V1C16V2C15C16", "consonant-vowel-index")
'THISISATEST'

Markdown

This is only for "encoding" (converting) Markdown to HTML.

Codec Conversions Aliases Comment
markdown Markdown --> HTML markdown, Markdown, md unidirectional !
>>> codext.encode("# Test\nparagraph", "markdown")
'<h1>Test</h1>\n\n<p>paragraph</p>\n'