All kinds of other codecs are categorized in "Others".

---

DNA¶

This implements the 8 methods of ATGC nucleotides following the rule of complementary pairing, according the literature about coding and computing of DNA sequences.

Codec	Conversions	Aliases	Comment
dna (rule 1)	text <-> DNA-1	dna1, dna-1, dna_1
dna (rule X)	text <-> DNA-X	...
dna (rule 8)	text <-> DNA-8	dna8, dna-8, dna_8

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

---

HTML Entities¶

This implements the full list of characters available at this reference.

Codec	Conversions	Aliases	Comment
html	text <-> HTML entities	html-entity, html_entities	implements entities according to this reference

>>> codext.encode("Тħĩş Їś ą Ţêšŧ", "html")
'Тħĩş Їś ą Ţêšŧ'
>>> codext.decode("Тħĩş Їś ą Ţêšŧ", "html-entities")
'Тħĩş Їś ą Ţêšŧ'

---

Letter indices¶

This encodes consonants and/or vowels with their respective indices. This codec is case insensitive, strips white spaces and only applies to letters.

Codec	Conversions	Aliases	Comment
consonant-indices	text <-> text with consonant indices	consonants_indices, consonants_index	while decoding, searches from the longest match, possibly not producing the original input
vowel-indices	text <-> text with vowel indices	vowels_indices, vowels_index
consonant-vowel-indices	text <-> text with consonant and vowel indices	consonants-vowels_index	prefixes consonants with C and vowels with V

>>> codext.encode("This is a test", "consonant-index")
'166I15I15A16E1516'
>>> codext.decode("166I15I15A16E1516", "consonant-index")
'THISISATEST'

>>> codext.encode("This is a test", "vowel-index")
'TH3S3S1T2ST'
>>> codext.decode("TH3S3S1T2ST", "vowel-index")
'THISISATEST'

>>> codext.encode("This is a test", "consonant-vowel-index")
'C16C6V3C15V3C15V1C16V2C15C16'
>>> codext.decode("C16C6V3C15V3C15V1C16V2C15C16", "consonant-vowel-index")
'THISISATEST'

---

Markdown¶

This is only for "encoding" (converting) Markdown to HTML.

Codec	Conversions	Aliases	Comment
markdown	Markdown --> HTML	markdown, Markdown, md	unidirectional !

>>> codext.encode("# Test\nparagraph", "markdown")
'<h1>Test</h1>\n\n<p>paragraph</p>\n'

---

URL¶

This handles URL encoding, regardless of the case when decoding and with no error.

Codec	Conversions	Aliases	Comment
url	text <-> URL encoded text	url, urlencode

>>> codecs.encode("?=this/is-a_test/../", "url")
'%3F%3Dthis%2Fis-a_test%2F%2E%2E%2F'
>>> codext.decode("%3F%3Dthis%2Fis-a_test%2F%2E%2E%2F", "urlencode")
'?=this/is-a_test/../'
>>> codext.decode("%3f%3dthis%2fis-a_test%2f%2e%2e%2f", "urlencode")
'?=this/is-a_test/../'